Talking Bird, Motorcycle Lost At Sea, Fashionistas, And More [Sunday News]

by 19 Comments

Every Sunday we gather the week’s weird Japanese news and present it to you in our Sunday News column. It might not always be hard-hitting, but we hope that it still informs and entertains you. Enjoy!
[hr]
[threecol_two]Google TranslateOpinions mixed on online translation tools: It’s not any surprise to me that a big chunk of people aren’t happy with online translators. Until computers reach Skynet levels of intelligence, online translators will always be a poor substitute for a real, live, human translator. But of course, once computers get that smart, the only language we’ll need to know is binary. 01001000 01100101 01101100 01110000 00100000 01110101 01110011 00100000 01100001 01101100 01101100 00100001 00001101 00001010 [via What Japan Thinks][/threecol_two] [threecol_one_last]Tsunami-swept Harley in container found in Canada: A little over a year after the 3/11 disaster, debris from the devastating Japanese tsunami has started to wash up on North American shores. First a volleyball a few weeks back, and now a whole motorcycle. Living on the west coast of the USA, I’m curious to see what washes ashore next. [via MSNBC]

Pet parakeet returned to Japanese owner after telling police his address: I gotta hand it to the owner of this parakeet – after having another pet bird fly away, he made sure to teach this bird his address so he can always find his way back home. I’d try to teach my pets my address, but I imagine I’d only be met with blank stares, followed by them licking themselves. [via Japundit][/threecol_one_last]
[hr]
[threecol_one]U.N. OKs Japan’s claim to extend continental shelf in Pacific: Last week, the U.N. recognized 310,000 km2 of continental shelf as Japanese territory, which I can only assume lays the groundwork for future Japanese underwater colonies. Sealab 2021, here we come! [via News On Japan]
Yahoo! Japan launches its own Android browser: Even as Yahoo! Inc. continues to circle the bowl before being flushed down, Yahoo! Japan continues to thrive, even beating out Google in Japan! To add insult to injury, Yahoo! Japan just released its own browser for Google’s Android operating system. All the while, Bing would just be happy if somebody noticed that it exists. [via Android Community][/threecol_one] [threecol_two_last]Interview with W. David Marx part 1: W. David Marx A.K.A. Marxy of Néojaponisme recently lent his time to The Fashion Post (“a fashion lifestyle journal for ultramodern people”) for an interview about his experiences writing about Japanese street fashion. An interesting read about Bathing Ape before the brand took off as an international phenomenon, and the humble beginnings of a Japan blogger. [via Néojaponisme Twitter][/threecol_two_last]

[Header image source]

  • Mescale

    010100110110010101101110011001000110100101101110011001110010000001101101011001010111001101110011011000010110011101100101011100110010000001100110011011110111001000100000011010000110010101101100011100000010000001101001011011100010000001100010011010010110111001100001011100100111100100100000011010010111001100100000011010100111010101110011011101000010000001110011011010010110110001101100011110010010110000100000011011100110111101110111001000000100100100100000011000110111001001110101011100110110100000100000011110010110111101110101001000000111000001110101011011100111100100100000011010000111010101101101011000010110111000101110

  • Xsuna

    Loving you guys’ binary messages. By the way, frankly, I have to say that I actually like online translation’s unreliable-ness.

    Cuz you have no idea how funny it is to see a friend try to surpass your year(s) of work at Japanese using an online translator, and fail miserably.

    (Friend friend to do this, with just 2 words, vegetable juice (Miku, ya know). Somehow managed to find not one, but 2 mistakes.

  • Xsuna

    Sorry, second “friend” on bottom line should be “tried”.

  • Smaugikun

    Online translators are useful if you know the ‘other’ language at least on an intermediate level. These translators should only be used as help to remember the words you already know and you forgot them somewhere in your head.

    I often forget some words in English or even in my maternal language, so I use google translator (which I think is the best) or in some cases just google spell check (:P). There’s a problem though. Spell checker and translators are ruining my knowledge. I became too lazy to recall, so instead I just use the mentioned tools. Laaaazy laaazy.

  • ですこ

     01001111 01001000 00100000 01000111 01001111 01000100 00100000 01001000 01001111 01010111 00100000 01000100 01001111 00100000 01001001 00100000 01010111 01001111 01010010 01001011 01000101 01000100 00100000 01000010 01001001 01001110 01000001 01010010 01011001 00100000 01010111 01001000 01000001 01010100 00100000 01001001 01010011 00100000 01010100 01001000 01001001 01010011 00100000 01001001 00100000 01000100 01001111 01001110 01010120 00100000 01000101 01010110 01000101 01001110

  • http://twitter.com/WackoMcGoose Kimura Okagawa

    I’d say that online translators are about 85% accurate for translating vocab (single words), and maybe only about 5% accurate when grammar is thrown in. However, that actually increases quite a bit if the original and target language have a similar grammar structure; English->German->English seems to have less “translation noise” than, say, English->Japanese->English.

    I wonder how it would do with Japanese->Korean->Japanese…

  • Kiriain

    Talking Bird, Motorcycle Lost At Sea, Fashionistas, And More [Sunday News]
    Talking Bird, Motorcycle Lost At Sea,
    Talking Bird,
    Talking Bird

    “A talking bird? AH SWEET!!”

    That was the only thing I noticed in the article’s title.

  • Smaugikun

    That’s about right, yes.

    The percentage of grammar  translation accuracy depends from the amount of text and of course the similarity of the languages. So i’d say the percentage is a bit higher than 5 % percent (accounting the amount and similarity), well at least at google translate. 

  • Mescale

    004C00650074007300200062006500200073006500720069006F00750073002000740068006F0075006700680020006F006E006C007900200038002000620069007400200063006F006D0070007500740065007200730020007500730065002000620069006E00610072007900200074006F00200063006F006D006D0075006E00690063006100740065002E0020004F00720020006F006300740061006C002000680061002000680061002000680061002E

  • http://mistersanity.blogspot.com Jonadab

    Individual words are actually not the ideal use case for online translators, because too many words have multiple meanings that don’t necessarily match up from one language to another.  I’ve found that they can often do better with judiciously selected short but essentially unambiguous phrases.  Still not perfect, but better.

    And yes, it helps if the user has at least some knowledge of both languages.  When translating *from* your native language *into* a language you’re studying, running the results back through to see if they come out reasonably can also be useful.  If you’re translating into your native language, that step is generally unnecessary, as you can usually evaluate the quality of the results immediately.

  • http://twitter.com/WackoMcGoose Kimura Okagawa

    Bing doesn’t exist. Also wait, Yahoo and Yahoo-Japan are two seperate companies? O_O

  • ですこ

     WWVhaCwgSSBrbm93IHJpZ2h0PyBXaGF0IHdhcyBJIHRoaW5raW5nLg==

  • Mescale

    GGCGGCTTGTGGGTGTGCGGGTACGCGGGTGAGCCAGCCGGCTCGCCTGCCGGCTCGCGTATTTGACGGCGCGCCGGCGTGTGGGTACGCGGGCGAGTCGGCTTGTGGGTGTGCGGGTACGCGGATCGATCGACGGGAATGGAAGGGGGCCGGCGAGCTAGCGGGTGAGCCGGCTGGCGGACTCGAAGGCTCGTCGGTGTGCAGGTCGGCTAGCGGGTGAGTATGTGGGTAAGTGAGCCAGCGGGCAGGCTCGTGAGCGGACTAGTATGCGGGCGGGCCGGCGCGTCGGCTTGTGGGCATGCAGGCTCGCACGCGGGCAGGTGAGTGAGCCAGCCGGTATGTCGGCTTGTGGGTATGCTTGCTCGCTTGCGCGCAGATGCATGGATAAATACACAG

  • http://www.tofugu.com koichi

     Yah, Yahoo Japan > Yahoo America by a long shot, too. There was rumors Yahoo Japan was going to buy out Yahoo America at a couple points, too – good thing they didn’t.

  • ですこ

    The only thing I can tell is that your nucleotide sequence has 132 amino acids.

  • http://www.vietamins.com Viet

    GATTACA

  • Mescale

    http://code.google.com/p/text2dna/

    Put that in your register and rotate the left 4 bits.

  • http://twitter.com/pcoletti pcoletti

    There are only 10 types of people who understand binary . . .those that do and those that don’t

  • ですこ

    There are people who understand binary that don’t understand binary? I’d thought that understanding it would be more, well, you know…